Direct damage to the backbone of DNA oligomers is influenced by the OH function at strand ends, by the type of base, and by the base context

Complete text of publication follows. Radiation damage to the deoxyribose of DNA results in stable end products consisting of strand breaks (sb) and free base release (fbr). Understanding the reaction mechanisms that lead to these products, following the direct action of ionizing radiation with DNA, is central to determining risk due to radiation exposure at low dose. The mechanism has been presumed to be straightforward: ejection of an electron from the DNA backbone produces a radical cation that deprotonates to yield a neutral carbon centered deoxyribose radical and, in the presence of water, these neutral radicals react to give sb and fbr. One would expect, therefore, that the sb/fbr site should be independent of the base at that site. By studying oligodeoxynucleotides of known sequence, we have found that this is not the case. Transparent films were prepared from palindromic deoxyoligonucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(CTCTCTTAATAATTATAATTATTAAGAGAG). d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATATTAAGAGAG), and the DNA in these films was hydrated to ∼2.5 waters per nucleotide. The films were irradiated at RT under air using X rays generated by a tungsten tube operated at 70 kV and 20 mA. The X-irradiated oligodeoxynucleotide films were immediately dissolved in nuclease free water and stored at 277 K for 24 hrs. Unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion + 2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each sequence. The observed changes in yields lead to the following conclusions: (i) phosphorylating the OH function quenches the end effect, (ii) the base at one end of the oligomer influences base release at the other end but only in shorter (10 bp) oligomers, (iii) the end effect is influenced by the base at the end and by the bases proximal to it, and (iv) the release of bases from internal positions is influenced by the base and its base context. Supported by PHS Grant 2-R01-CA32546 of the NCI.